alvarocalveteperis alvarocalveteperis

06-02-2022
Biology

contestada

why fat digestion does not oocur in the stomach

Respuesta :

patriciafelei2006 patriciafelei2006

06-02-2022

Answer:

Fat digestion begins in the stomach. Some of the byproducts of fat digestion can be directly absorbed in the stomach. When the fat enters the small intestine, the gallbladder and pancreas secrete substances to further break down the fat.

Answer Link

Otras preguntas

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Right triangle $ABC$ has one leg of length 6 cm, one leg of length 8 cm and a right angle at $A$. A square has one side on the hypotenuse of triangle $ABC$ and

The objects in this photo belong to which major sphere of the Earth system?

You just bought a new tablet computer for $500, including tax. There are no required payments for six months, but the company does charge 30% annual interest, c

6. According to paragraph 6, M. Fortier is happiest

The following equations define a system. −2x + y = 10 x + 2y = 5 Which graph represents the system? The graph shows a line that passes through negative 5 comma

which reason of India have high population density

Match the solution to its expression.

Why was the Louisiana Purchase good for France and USA

George peels and eats 2 whole satsumas. He then splits another satsuma into 6 equal segments and eats 1 of these segments. How many satsumas does he eat in tota