dayshawn120799 dayshawn120799

10-01-2023
Biology

contestada

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Respuesta :

Otras preguntas

Lynn has a watering can that holds 32 cups of water, and she fills it half full. Then she waters her 27 plants so that each plant gets the same amount of water.

Selectively permeable membranes allow only certain materials to pass through them.t/f?

internal membrane system that helps make proteins ...

-9 + (-2)²help!! see im trying to get math done so i need help

Christians estimates that she will spend $250 on new summer clothes.She actually spent $350. What is the percent error?Round to the nearest whole percent

Which of the following is the best evidence that digestion involves chemical change? A Time is required to accomplish results. B The products’ mass equals the r

What is the answer to: -45=x+(-3)+50

Explain how energy is transferred in a food web.

What elements do alkaline earth metals react with

What is 2/5 plus 1/3