glowbaby123
glowbaby123 glowbaby123
  • 07-01-2019
  • Mathematics
contestada

Help with 1-3 please... I really need to get a 100 on this! I will reward brainliest.

Help with 13 please I really need to get a 100 on this I will reward brainliest class=

Respuesta :

jaimejohnston2
jaimejohnston2 jaimejohnston2
  • 07-01-2019

Answer:

A, C, C

Step-by-step explanation:

Idk about the last one, but the rest are right.

Answer Link

Otras preguntas

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
Which of the Sumerian achievements do you feel had the most impact on their society? Explain if it still has an impact on our society today.
Identify the function of nonverbal communication in action below. Select all that apply. Marsha's interview for her dream job is tomorrow. She stops by the sal
In a cooking context, which of the following materials is the best heat conductor? A. Gas B. Glass C. Any dense liquid D. Iron
At 0.0 degrees Celsius, a wire cable is 410.0000 meters in length. When the temperature increased to 30.0 degrees Celsius, the wire increased in length by 0.344
Danny charges $35 for 3 hours of swimming lessons. Martin charges $24 for 2 hours of swimming lessons. Offers a better deal
A landscaper has 4/5 bag of potting soil to fill some planters.If the landscaper pours 2/15 bag of soil into each planter until the bag is empty how many plante
The author's attitude towards a subject is the ____ of the writing.
what did the great queen to that is so important? real long please
PLEASE HELP ASAP 25 PTS + BRAINLIEST TO RIGHT/BEST ANSWER