ghunderman24 ghunderman24

09-01-2019
Chemistry

contestada

What is the complementary DNA strand for the following sequence:
ATGGCTTGCCAAGGTCCGGAAACTTTG

Respuesta :

alexandraderigg alexandraderigg

09-01-2019

TACCGAACGGTTCCAGGCCTTTCAAAG

Answer Link

Otras preguntas

Better hygiene, education, and wealth correlated with?

what is 10 times 2 divided by 5 times 20

which is the longest latitude? why?

According to the information in the Unit, which of the following sentences is most specific and effective? Lamar, saddened by his noble and honored grandfather'

You go to school for only half a day. Instead of taking the normal classes such as Math, Reading, and Science, you are learning to cook food, do laundry, and do

Identify the sentence in which all words are used and spelled correctly. A. The principal evidence is a gun with his fingerprints on it. B. The principles evid

GeoGebra Task 8 1. Identify a figure that is the result of a ridgid transformation of a quadrilateral ABCD TASK 9 1. Describe a rigid transformation that would

If i were to leave 2 dollars and i had 12 in my pocket how many would be gone?

An office supply store in Newport purchased a printer at a cost of $175 and marked it up 45%. Later on, Oliver bought the printer. If the sales tax in Newport i

differents parts of a nephron in order