campbellnancy7ouwlc8 campbellnancy7ouwlc8

09-02-2018
Social Studies

contestada

what should be the responsibilities of the media and interest groups in a democracy

Respuesta :

nonversxtion nonversxtion

09-02-2018

One responsibility of the media in a democracy is to inform the public about current events - both in a fair and unbiased way.

Answer Link

Otras preguntas

Hey can you please help me posted picture of question

The products of the decomposition can diffuse out of the lysosome and into the ____________ or be removed from the cell via the process called ____________ .

The life of a certain brand of battery is normally distributed, with mean 128 hours and standard deviation 16 hours. what is the probability that a battery you

A carnival game allows a group of players to each draw and keep a marble from a bag. The bag contains 5 gold marbles, 25 silver marbles, and 70 red marbles. A p

The very sad event in his life to which gatsby refers to

) during a session, henry becomes agitated at his therapist, saying that she is controlling, domineering, and trying to ruin his life. a psychoanalyst would say

Identify the function in which Y varies directly with X

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

What is the frequency of a pressure wave of wavelength 2.5 m that is traveling at 1400 m/s?

The united states opposed mandated elections in vietnam in 1956 for what reason?