aliamiranda04 aliamiranda04
  • 09-02-2018
  • Chemistry
contestada

a carbon atom has four valence electrons what is the greatest number of bonds a carbon atom can form with other atoms

Respuesta :

ahmedzedn120p3vd9s
ahmedzedn120p3vd9s ahmedzedn120p3vd9s
  • 09-02-2018
the greatest number of bonds carbon atom can form is 4 bonds as in methane
Answer Link

Otras preguntas

Find all the roots of the equation x^4-4x^3+x^2+12x-12=0
In 1713 france owned most of what part if North America
What is the answer to 3/10x120
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
I need help please? Just for b, c, and d.
Two lakes have the same number of species. most of the fish in lake 1 are of a single species, with a few individuals each for the remaining species. lake 2, on
What is the algebraic expression for: four less than three times the number of egg orders and six more than two times the number of waffle orders
1. Solve for w. w−8=32 A 4 B 40 C. 256 D. 24 2. Solve for n. n + 8.7 = 16.2 A. 6.5 B. 7.5 C. 8.5 D. 24.9
Which sentences describe why the Portuguese chose to grow sugar on their plantations?
What type of christianity did the byzantine empire or byzantine create?