deb1oobo4dnebc deb1oobo4dnebc

10-03-2017
Mathematics

contestada

The expression (2x2)3 is equivalent to _____.

Respuesta :

Paradime Paradime

10-03-2017

since 2*2 is = 4 we can say (4)3.

what (4)3 means is (4) * 3

since this is an expression, you wont solve any further

Answer Link

Otras preguntas

Lady Macbeth uses a familiar technique to try to get her husband under control. Which quote best represents this q) she takes control and does it herself r) she

Please help I don't understand this. I will give brainy and 10pts

The diameter of a circle is two and 1/2 inches what is the length of the radius of the circle

The entries that transfer the revenue, expense, and withdrawals balances to the Owner, Capital account to prepare the company's books for the next period are ca

A zombie apocalypse wipes out almost the entire human species before the zombie threat is eliminated. Only a group of 100 people who were at a family reunion on

If James rolls the number cube 250 times, predict the number of times it will land on an odd number

Select the correct text in the passage. Which sentence in this excerpt from the Declaration of Independence indicates that the colonists did not wish to remain

If the domain is {0, 2, -6}, what is the range of y = -2x + 3?

What is the volume of the primes shown in the cubic units round the nearest whole number if necessary A 67 B 200 C 105

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?