cricket665 cricket665
  • 08-03-2017
  • Mathematics
contestada

the quotient of a number and four decreased by ten is two. what is the number

Respuesta :

bubbob1544
bubbob1544 bubbob1544
  • 08-03-2017
(x÷4)−10=2

x/4= 12

x= 12*4

x= 48
Answer Link

Otras preguntas

A toy car moves 3.5 m on a ramp with a force of 5.5N. How much work does the toy car do?
Imagine that you have a roommate who is a slob and you would like to change this behavior. From your knowledge of conditioning principles, how would you encour
Which of the following would result in a reduction of GDP? A. Imports increase faster than exports. B.farm income stagnates. C.investment increases D.the unemp
Find the 9th term in the arithmetic sequence: 6, 2, -2,…
Help with this pls????
Megan submitted a story to a Wizard of Oz fan-fiction website. The reader reviews were mostly positive, but one reviewer wrote that Megan could have better deve
Can someone help me I need this is less then 10 mins because I’m timed
If changed, which detail would change this from science fiction to fantasy fiction? A. lights going on and off in the houses as a result of electrical outages B
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC Complementary Strand:
an old saying is that " oil and water don't mix. Explain the molecular basis for this saying