benjamink3ll3y benjamink3ll3y
  • 09-05-2022
  • Medicine
contestada

Fracture of the CMC
Joint of the thunb from
axial and abduction Force

Respuesta :

xxXHapitotXxx
xxXHapitotXxx xxXHapitotXxx
  • 09-05-2022

Answer:

Thumb ligament injuries usually occur from a forced radial deviation (abduction) of the thumb during a high-velocity activity. Skiers and those who play ball-handling sports, such as baseball, football and basketball, have a greater risk of sustaining such an injury.

Answer Link

Otras preguntas

simplify completely 3x^2+21x-54 over x^2+3x-54
What is the simple interest that is missing from the table? p $375 r 2.2% t 3 years
I don’t know this one I need help
To make learning more meaningful, the learner must...? repeat the new information many times aloud make associations with already learned knowledge take
Astronauts who visit and stay at the International Space Station are also scientists because they A) participate in the race into space. B) collect data to imp
Describe one limiting factor for the moose population
Where does carbon come from in a winogradsky column? 2. why is carbon important? 3. what purpose does calcium sulfate serve in the winogradsky column? 4. wh
What did muhammad and his soldiers destroy when they returned to mecca and conquered it in a.d. 630?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Smooth muscle in the walls of the urine move urine along to the bladder by