wittchenjoanna wittchenjoanna

09-03-2022
Mathematics

contestada

Which of the following numbers is farthest from the number 2 on the number line
3 -3 6 -6 10

Respuesta :

hazelmilomillie3 hazelmilomillie3

09-03-2022

Answer:

-6 is the correct answer

Step-by-step explanation:

Answer Link

Otras preguntas

The electric current running through the wire coil in an electric motor exerts force directly onto A) the battery. B) an aluminum axle. C) a powerful magnet.

Moira simplifies the expression 6y4+3y4 to 9y8 . Use the drop-down menus to complete the statements below to explain why Moira's solution is correct or incor

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Which describes a metaphase plate? sister chromatids lining up in the center of the cell parent cells dividing into two daughter cells spindle fibers pinching t

whichh of the following is a first level managerial duty

2. The formula for density is where m is mass and V is volume. If the volume inside the packet decreases, what would happen to the density of the air inside the

write the proper word equation to express the following chemical reaction: 3Li (s) + AuCI3 (aq) -> 3LiCI (aq) + Au(s)

what does nucleus do inside a cell?a.protective coveringb.stores food,water,wastec.control center that directs cell activitiesd.produces protein (on ER)

True or false: In Florida, the number of alcohol-related traffic deaths increased in 2008cpared to 2007

Factor each polynomial. Check your answer by distributing. 2x^2+5x+2