rhasan8966 rhasan8966

09-11-2021
Mathematics

contestada

A rug measures 2 1/3 yards by 11/4 yards. What is the area of the rug

Respuesta :

09-11-2021

Answer:

2 11/12 sq yards

I hope this helps :D , and if it does plz give brainliest

Step-by-step explanation:

Answer Link

Otras preguntas

The diagram represents the functional unit of a nervous system. Which structure secrets a neurotransmitter.

Evaluate the following expression using order of operations: 8+20÷5×2

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D

Can you give me answer to both questions am confused . Thank you .

The principle difference between point source and nonpoint source water pollution is _______. a. whether the pollution is organic or inorganic b. the number of

HELPPPPPPPP NOWWWW! WILL MARK BRAINLIESTTTTT! 1. What is the equation of the line that is parallel to the given line and passes through the point (–2, 2)? 2. A

An allele that overpowers another allele and is expressed when it is found in the genotype is said to be Question 2 options: recessive homozygous dominant. chro

In a free market, what is a signal to sellers what should be produced and how to produce?

They spotted a pod of whales driving along the ocean highway

How would you know if two vectors are perpendicular?