Lenah1437 Lenah1437

06-10-2021
Social Studies

contestada

the fact that you are more likely to earn more money over your lifetime with a post secondary degree means...

Respuesta :

Аноним Аноним

06-10-2021

Answer:

You should probably stay in school and pursue higher education with that end goal in mind.

Explanation:

Answer Link

Otras preguntas

How does seafloor spreading move plates?

Rob is taking part in an expedition to climb Mt. Everest, which is 29,035 feet above sea level. The group climbs 3028 feet the first day, 4562 feet the second d

Simplify the expression.- (m + 6n - 11)

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

Net exports are defined as the ___________. A. value of foreign assets held by domestic individuals minus the value of domestic assets held by foreigners. B. v

A weightlifter works out at the gym each day. Part of her routine is to lie on her back and lift a 41kg barbell straight up from chest height to full arm extens

Which influence technique involves asking for a small request in order to increase the likelihood of the target complying with a larger request later?

which of these best describes the full faith and credit clause

A line includes the points (7,4) and (8,6). What is it’s equation in slope- intercept form?

PLZ HELP Look at the image, read, and select the correct sentence that matches the image. Store worker showing grapes to a customer ¿Le encanta la uva? ¿Le en