lanilove2227 lanilove2227

07-05-2021
Mathematics

contestada

what is 37 and 4/8 rounded to the nearest whole number

Respuesta :

millieng millieng

07-05-2021

Answer:

38

Step-by-step explanation:

Answer Link

leslyleon800 leslyleon800

07-05-2021

Answer:

38

Step-by-step explanation:

Answer Link

Otras preguntas

1. A 75.0 kg man pushes on a 500,000kg wall for 250s but it does not move. How much work does he do on the wall?

Below is a chart that shows the number of Electoral Votes (EV) that each state gets. The bigger the state’s population, the more votes it gets. Forget the numbe

Kenny drank 37 ounces of milk during the day. How many cups of milk did he drink?

Read the poem. I Dwell In Possibility by Emily Dickinson I dwell in Possibility – A fairer House than Prose – More numerous of Windows – Superior – for Doors –

Why do u think Rome is still an important city today ?

a card is picked at random from a pack of 52 playingcards. what is the probobilityof selecting a spade

AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of

the ratio of the measures of the side lengths of a quadrilateral is 2:3:5:4. the perimeter is 154 feet. find the length of the shortest side.

Can someone please help me?

The length, width and height of a rectangular prism is given as 15 cm, 10 cm and 5 cm respectively. What is the volume of the prism? * A) 30cm3 B)150cm3 C)750cm