nba73 nba73
  • 10-04-2021
  • Mathematics
contestada

The sum of two consecutive odd integers is fourteen.

Respuesta :

leachc08 leachc08
  • 10-04-2021
There is no solution. The sum of two consecutive integers will always be ODD. -14 is even
Answer Link

Otras preguntas

Calculate the hourly wage of an employee who earned $127.50 in 141/4 (14.25) hours.
To make new cells, humans undergo a process of cell division called mitosis. Before a cell goes through cell division (mitosis), which process must be carried o
In Keith Basso's research with the Western Apache of Arizona, places in the landscape were
What 2 parts of an atom does the atomic number represent?
Winston Churchill, who would become the British prime minister in 1940 described which agreement as a 'defeat without a war'?
Frank worked 8hours on the first four days of the week and 9hours on the fifth day he did this for 4weeks in a row. How many total hours did Frank work
A car wheel is 56 cm in diameter. A. How far does the car go in one revolution of the wheel? B. How far does it go in 100 revolutions?
Proven by written evidence
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this m
What are two primary arguments of the Anti-Imperialist League?​