masahamad
masahamad masahamad
  • 09-04-2021
  • Biology
contestada

Determine the mRNA and amino acid sequence for the below DNA sequence.

Determine the mRNA and amino acid sequence for the below DNA sequence class=

Respuesta :

mariawaelramzy mariawaelramzy
  • 09-04-2021
AUGAGCCCCGCUAGGUUCUC
Answer Link

Otras preguntas

6(y+4)^2-5=49 a). y = -2 or y = -6 b). y = -1 or y = -7 c). y = 0 or y = -4 d). NO REAL SOLUTIONS
If a represent the number of apples purchase at 15 centa each and B represents the number of banana purchase at 10 cents each, which of the following representa
A document is any written or printed text gives an opinion or idea. true or false
Douglass's account is written in 1881, twenty-two years after the raid.Do you trust his account?
What's 6253 divided by 71
6^x = 216 how to solve? 6 to the power of x equals 216.
In the 1500s, the Council of Trent was led by a group of
The main goal of the american revolution was to gain?
Which statement about changes that occurred during the Industrial Revolution is true? a. Agriculture was the first part of the economy transformed by machines.
Which best defines the term muckraker? a. a sanitation worker who cleans city streets b. a factory employee who oils machinery c. a corrupt politician who embez