Xoxo101
Xoxo101 Xoxo101
  • 08-03-2021
  • Mathematics
contestada

Help please!! I'm timed.

​

Help please Im timed class=

Respuesta :

cassandralozan8 cassandralozan8
  • 08-03-2021
answer: 42

explanation : 90-48=41
Answer Link

Otras preguntas

Which number is equivalent to 34/32
Suppose calls are arriving at a telephone exchange at an average rate of one per second, according to a Poisson arrival process. Find: a) the probability that t
If you can complete 4 problems on a test in 9 minutes, how many problems can you finish in 10 minutes
If 8.20 kJ of heat is needed to raise the temperature of a sample of metal from 12°C to 29°C, how many kilojoules of heat will be required to raise the temperat
Globalization: a. had little to do with the collapse of communism. b. was symbolized by corporations such as Microsoft and organizations like the WTO. c. is clo
The number 42 is 15% of x. What is the value of x ?
A teacher plans a simulation to estimate the probability that a student will pick a vowel out of a bag of 26 tiles, each with a different letter of the alphabet
Finish the sentence using a simile or a metaphor “I woke up in the morning ________.”
Richard drives from his home to work at an average speed of 50 miles per hour . Later he drives from his work to home at a speed of 60 miles per hour. What is h
Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​