infernoflame2x000 infernoflame2x000
  • 06-03-2021
  • Chemistry
contestada

boyle's law and charles' law! PLEASE HELP!!!! DUE TODAY!!!!

boyles law and charles law PLEASE HELP DUE TODAY class=

Respuesta :

mojereamuludun
mojereamuludun mojereamuludun
  • 06-03-2021

Answer:

boyles law state that the volume of a fixed mass is directly proportional to the absolute temperature given that the pressure is constant Charles law state that the volume of a fixed mass is inversely proportional to the pressure given that the temperature is constant

Answer Link

Otras preguntas

SOMEONE PLEASE HELP ME!!!!!!! In a phrase, tell me what each scientist did to help develop the cell theory. Scientists: Hooke, Leeuwenhoek, Schleiden, Schwa
A 1500 kg car has the same momentum as a 2500 kg truck moving at 25 m/s. How fast is the car moving in m/s
han earns $33,00 for babysitting 4 hours. at this rate, how much will he earn if he babysits for 7 hours?
Transcribe the following Strand of DNA: GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
The electron configuration of a cation with a 2+ charge is shown below. 1s22s22p63s23p6 What is the electron configuration for the ion's neutral parent atom? Th
(Select all that apply.) The mismatch of a DNA base pair during duplication can result in a _____. recombination mutation change differentiation
Please help (30 points) Versailles treaty
helppppppppppppppppppppppppppppp
Gabe has a savings account at the local bank. He deposits $150 in his account every 2 months. Which equation models the relationship between the months that dep
which group had the greatest success in converting people outside europe to christianity?