hankinsalissa
hankinsalissa hankinsalissa
  • 09-11-2016
  • Mathematics
contestada

i need help again and the question is 2 1/2 and 28/10 and i need to know if it is greater than or less than or equal to

Respuesta :

Аноним Аноним
  • 09-11-2016
28/10 is 2 4/5
so 28/10 is greater than 2 1/2
Answer Link
john123aba john123aba
  • 09-11-2016
28/10 will be simplified to 2 4/5 so 28/10 is greater than 2 1/2
Answer Link

Otras preguntas

why is henry higgins counting his money
Which of the following does not describe much of Europe at the end of World War II? A. Many people were displaced and much of Europe lay in ruins. B. Nuclear
Two people get divorced, and they end up in family court. the mother is an accountant who makes about twice the father's income. they both have bachelor's degre
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Candy brings George into the barn to show him the lifeless body of Curley's wife. What is Candy's biggest fear as they witness this tragic scene? A. That Georg
WILL GIVE BRAINLIEST IF YOU ANSWER ALL OF THEM
Nina wants to put color tiles on a square. 3 color tiles fit across the top of the square. How many rows and columns of square will Nina need? How many color ti
What is the numerator of the fraction equivalent to 24/144 that has a denominator of 18
census record for China and India would most likely be used to support which conclusions regarding the two nations
What was the outcome of the Battle of Antietam?