imurfanthinking imurfanthinking

10-02-2021
History

contestada

When Apollo 8 orbited the moon what could people on Earth see for the first time?

Respuesta :

Midnightclaw365 Midnightclaw365

10-02-2021

Answer:

the earth as a sphere in space

Explanation:

Answer Link

Otras preguntas

Which group of e.coli produces a shiga toxin somewhat similar to that produced by shigella dysenteriae?

Clem Colfax had $10 to buy groceries. He needed milk costing 70 cents a carton, bread costing 60 cents a loaf, breakfast cereal costing 50 cents a box, and meat

Justin enrolls in a local community college so he can one day become an engineer. justin is about to become a member of a:

if an object has a mass of 60 grams on earth, what is its weight on the moon?

what is the distance between 2-3i and 9+21i

What museum did the cathedral of art in Mexico infiltrate?

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Indicate a process that cycles carbon dioxide from living or non living organisms

5-2i and 7+6i find the midpoint

Which properties make a metal a good material to use for electrical wires? malleability and reactivity conductivity and ductility ductility and malleability re