Seudónimo Seudónimo
  • 09-01-2021
  • Computers and Technology
contestada

Which line of code will display the variable rounded to the nearest tenth?
print(num, round)
print(round(num, 1))
print(num rounded)
print(round(num,.1))

Respuesta :

trduunze trduunze
  • 09-01-2021

Answer:

print(round(num, 1))

Answer Link
derricktipton
derricktipton derricktipton
  • 16-02-2022

Answer:

D

Explanation:

Answer Link

Otras preguntas

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
how was the seneca falls convention related to abolitionism
Can someone please help me with this? (also don’t mind the answer i chose)
atoms bond because they become more ____ when they have ____ outer ______.
The admission to a local fair is $10 for each adult and $6 for each child. Each ride costs $1.50 for an adult and $1 for a child. An adult and a child each go o
A grass snake living in northern England dies of natural causes. After a long period of time, its remains decay in the soil to become fossil fuel. When the foss
Franco has 7 quarters in his pocket. Of these, 3 depict the state of Delaware, 2 depict Georgia, 1 depicts Connecticut and 1 depicts Pennsylvania. Franco remove
Which situations show examples of work occurring? Check all that apply. A student carries a stack of books to the library. A shopping cart is pushed through a p
A restraunt bill before tax is $15.50. How much is a 15% tip for this bill?!
The number line shows the graph of an inequality: A number line is shown from negative 5 to positive 5 with increments of 0.5. All the whole numbers are labeled