jls7281 jls7281

08-01-2021
Biology

contestada

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Respuesta :

mathsbeginer mathsbeginer

12-01-2021

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Answer Link

Otras preguntas

To calculate the inventory to be purchased in a merchandise purchases budget, the formula is?

Gaden company sells a product for $50 per unit. Warialbe costs are $40 per unit. Calculate the contribution margin per unit, in total, and as a ratio.

Which term best describes the temperature and weather conditions of an organism’s environment? Which term best describes an organism that can contain up to five

Government policies to promote long term economic growth might include: ______.

Sound intensity, I, from a spherical source is a function of the distance, r, from the source of the sound. It is represented by the function uppercase I

A musician charges C (x) = 64x + 20, 000, where x is the total number of attendees at the concert. The venue charges $80 per ticket. After how many people buy t

4. Identify and discuss four factors influencing people’s attitudes to fitness.

How to do [7^{6} * (2/7)^{5}] ÷ (2^{2}). FIRST TO ANSWER WILL BE MARKED AS BRAINLIEST/

Read the paragraph. after the final battle, rumor had it that a few renegades had slipped off into the forest to avoid capture. these sneaky rogues have continu

What is the economic application of change of state?