ashleygarcia090817 ashleygarcia090817

06-01-2021
Biology

contestada

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Respuesta :

homadison4 homadison4

09-01-2021

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Answer Link

Otras preguntas

An electronics store discovers that it can sell 5 televisions per day by pricing them at $150. When the televisions are on sale for $100 the store sells 10 of

I need help with number 33

Given a mean of 100, and a standard deviation of 5.3, what is the Z-score for 130?

Which geometric object is defined as the set of all points in a plane equidistant from a single point and a single line

What is the area of a semicircle whose perimeter is 72cm

Find the measure of the line segment indicated. Assume that lines which appear tangent are tangent. A) 10 B) 6 C) 14 D) 7

Do you think that social media may cause ADHD?

The bar graph and line plot show the same temperatures. Where should you look to find the least common temperature?

DNA joins to another DNA molecule from which part of the DNA?

Need help ASAP!!!!!!