dvanada07p5aj6q dvanada07p5aj6q

10-12-2020
Chemistry

contestada

Balance the following chemical equation:
_HCO + _O —> _H2 + _CO3

Respuesta :

ven22514 ven22514

08-05-2022

Answer:

Balanced Equation:

2HCO + 4O –––> H2 + 2CO3

Answer Link

Otras preguntas

what happens to the surface area of a rectangular prism when the dimensions are halved.

If the interest rate on a savings account is 0.02%, approximately how much money do you need to keep in this account for 1 year to earn enough interest to cover

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D

If we divide x^4+4x^3+2x^2+x+4 by x^2+3x, what will be the remainder?

A poem rhyme scheme is usually marked with

which statement is true about groups? A. In triads, two members often become the group's mediators. B. The smallest groups are the most stable. C. Dyads are m

The sum of the ages of the three romano brothers is 63. if their ages can be represented as consecutive integers, what is the age of the middle brother?

what is the scale factor of the dilation?

What is (386)(204) in scientific notation

Explain why units can be simplified first when measurements are multiplied?