jonaerne jonaerne
  • 07-10-2020
  • Physics
contestada

What are the units of atmospheric pressure?

Respuesta :

xxpepu47
xxpepu47 xxpepu47
  • 07-10-2020

Answer:

a unit of pressure defined as 101325 Pa

Explanation:

Answer Link

Otras preguntas

What was the main method used by the ku klux klan to restore white control in the south?
Write the equilibrium-constant kp expression for the reaction a(g) + 2b(l) = 4c(g) + d(g)
Simplify 8√27 (show work)
When you cross two heterozygotes (aa), the offspring will most likely be __________?
Why do you think that it is necessary to break down the executive branch into so many different jobs?
Arteries carry oxygenated blood away from the heart and typically have ________________ blood pressure. Veins carry deoxygenated blood to the heart and typicall
Which regular polygon would have each of its interior angles measure 120°? hexagon heptagon octagon nonagon?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
hat is the sum of the geometric series in which a1 = 3, r = 4, and an = 49,152? Hint: an = a1(r)n − 1, where a1 is the first term and r is the common ratio.
The length of a rectangle is 5 yd less than three times the width, and the area of the rectangle is 28 yd2 . find the dimensions of the rectangle.