Seudónimo Seudónimo
  • 10-11-2014
  • Mathematics
contestada

What is the slope of the line?

y= -5x - 9

slope = ______
fill in the blank

Respuesta :

hannahblunt hannahblunt
  • 10-11-2014
the line has a gradient of -5 and an intercept of -9.
so on a graph it would go 5 down and 9 across (towards the left of the graph)
Answer Link
Аноним Аноним
  • 10-11-2014
y=-5x-9
Use y=mx+b
The slope is -5 .
Hope it helps.
Answer Link

Otras preguntas

convert 8x-10y=20 into slope intercept form
AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of
Common law marriage does not require which of the following conditions?
Brooke decides to model a lunar eclipse. She attaches a large poster of the Sun to her wall to represent the Sun. She then decides that her head will represent
A sample of gas has a volume of 20.0 mL at STP. What will the volume be if the temperature is changed to 546 K and the pressure is changed to 2.0 atm.? (show wo
What was the Catholic Church the main source of?
I need help on this question reallyyyyy fast
How old is Abraham Lincoln and when did he die
Do you think most Cos-players don't dress up for fun but only to feel more closer to being the character and start trying to act like the character and forget w
please please please please