prinsikasapkota prinsikasapkota

07-09-2020
Social Studies

contestada

write down the historical background of Nepali painting

Respuesta :

intelligent38 intelligent38

07-09-2020

Explanation:

to country the 7th century AD. ... Researchers have discovered much Buddhist art

Answer Link

Otras preguntas

your flat was entered into by a bandit of armed robber and all removable materials were stolen through the police you recovered all the stolen material . give a

Which polynomial is a factor of both expressions? x – 8 x + 7 x – 2 (x – 2)2

Look at the DNA sequence (1st Picture) Which sequence shows a substitution mutation? (2nd Picture)Also, can you explain how you got the correct answer?

To make a project, you need a rectangular piece of fabric 3 ft wide and 4 ft long. How many square feet of fabric do you need? I

Find the square root of 2601 by prime factorization (USE MULTIPLICATION METHOD TO SOLVE THE ABOVE QUESTION)

Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC How many bases are in the second fragment?

An octagonal pyramid ... how many faces does it have, how many vertices and how many edges? A triangular prism ... how many faces does it have, how many vertice

A certain forest covers an area of 2600 km^2. Suppose that each year this area decreases by 4.75%. What will the area be after 11 years? Use the calculator prov

i need this quick!!! please hurry!! Solve the following proportion for X. X over 5 = 17 over 3 Round your answer to the nearest tenth.

TRUE OR FALSE:the rising stock market helped working class Americans save money.