hulettw hulettw

07-09-2020
Mathematics

contestada

Anumber is decreased by 55% to 54. What is the originally amount

Respuesta :

NyjahHutton NyjahHutton

07-09-2020

Answer:

1.8181818181818181818181818181818

Answer Link

Otras preguntas

What are the y values for the equation : y=0X-4 if x=-3

Solve the equation: 9x - 5 = 5x + 7

The school store sells pens for $0.70 each and pencils for $0.30 each. Anthony spent $2.70 to buy a total of 5 pens and pencils.How many pencils did Anthony buy

Read the summary paragraph for the article on service and answer the question that follows: Service improves society, impacting the helpers as wel as those neod

How did the term “prairie style” come to be? a. The roofs and terraces that jut outward into the environment echo the horizontal space of the prairie. b. Homes

AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of

A cookie recipe that yields 36 cookies calls for 2 cups of flour. Rhea has 7 cups of flour. How many cookies can she make? Use at least 2 ways to show your answ

Hey you. I'm happy you are alive. <3333

D. the area of the interior square in step 2 is equal to c² + ab.I'll give u brainly if u right

What does the mayflower compact say about equality, and how might this view have influenced the system of government in the United States.