blossyblazeyt blossyblazeyt

10-07-2020
Mathematics

contestada

help please :))))))))

help please class=

Respuesta :

suryanshu32 suryanshu32

10-07-2020

Answer: 35/24 is the answer for the first part only.

Use calculator soup on google search to answer the rest.

Step-by-step explanation:

Answer Link

Otras preguntas

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

An athlete training daily and expending large amounts of energy should consume _____ of carbohydrate daily or approximately ______ of total calories. Choose the

A company has a monthly budget of x dollars. Every month, $20,700 of the monthly budget is spent on salaries. One-fifth of the remaining budget is spent on offi

3x^2+x+1=0 Please show your work to see how you even solve this thanks !

I am leaving for England tomorrow change to future tenes

Workers are preparing RUTF peanut butter, and are mixing oil, sugar, peanut butter, and milk powder together. Which ingredient in this RUTF peanut butter would

What are the answers for all of them and put letters next to the answers for each one

The following is an example of the moral-hazard problem: Homebuyers do not properly evaluate the risks involved in buying a home because they are assuming gover

Which expression is equivalent to one over fivem − 20?

Federalism allows increased O A. citizen participation and self-governance O B. efficient delivery of public services OC. innovation and choice of public servic