lolz2004 lolz2004

10-10-2019
Mathematics

contestada

Find f(-3) if f(x) = x^2.

Respuesta :

victoria20056 victoria20056

10-10-2019

Hopefully that’s help u :)

Ver imagen victoria20056

Answer Link

mateoh1226 mateoh1226

10-10-2019

Answer:

f(-3)=9

Step-by-step explanation:

f(x)=x^2

To find f(-3) replace x in the function by −3

Therefore: f(-3)=(-3)^2 =−12×32=1×9=9

Answer Link

Otras preguntas

How many solutions does the equation have? 4(x-3)=4x-12

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Sylvia is a member of a team that uses e-mail, messenger, and blogging to communicate. although she sees members of her team on breaks and at lunch, sylvia does

What is the equation of the line that passes through (4, -1) and (-2, 3)?

What is the problem with using credit cards if you pay your balance off each month?

What is the inverse of the function f(x) = 2x – 10?

which of these helped lower unemployment and raise GDP after the great recession

Which of the following is an atom that has gained an electron? Select one: a. positive ion b. nonpolar molecule c. polar molecule d. negative ion

Help mehhhhhhhhhhhhhhhhhhhh • Stable government during the Ming Dynasty • Surplus food grown in agriculture • Growing production of silk, textiles, and porcelai

Identify the type of bonding molecular geometry and intermolecular forced experienced by the compounds hf and hbr which substance would experience a stronger at