dkdjdndnd dkdjdndnd

10-10-2019
Mathematics

contestada

PQ bisects ZSPY. MZSPQ = 12x - 5 and mZYPQ = 4x –
Solve for x and find m_SPY.

Respuesta :

cocomarie cocomarie

10-10-2019

12x5=60 his spy is 60

Answer Link

Otras preguntas

Thai and Mexican food would be examples of what type of cuisine? Regional cuisine Classic cuisine Nouvelle cuisine National cuisine

how might q teen's health and social life be affected if the teen tested positive for HIV

Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC How many bases are in the second fragment?

Hi if anyone is able to simplify this problem please help me and do so

why is road transport most common in nepal

Determine whether the sequence converges or diverges. If it converges, find the limit. (If an answer does not exist, enter DNE.) an = (−3^n)/(4n!)

The largest circular shape my piece of string can form has a diameter of 8 cm long. How long is the diameter of the largest circular shape that half my piece of

A screen is placed a distance dd to the right of an object. A converging lens with focal length ff is placed between the object and the screen. In terms of f, w

When entering a foreign market, Montain stream brewery purchases a manufacturing plant and sets up a new brewery. Instead of using their signature name, the pro

Which sentence is an example of two independent clauses being linked by a semicolon and acoordinating conjunction?Select one:O a. (2) He has found success in ma