alleab alleab
  • 08-04-2019
  • Social Studies
contestada

Conduct both secondary research and participant observation

Respuesta :

tyjae1601 tyjae1601
  • 08-04-2019

We need more information. What are we conducting research on? What are we observing? What exactly am I supposed to be writing about? Give me more information and I'll try to help you the best I can.

Answer Link

Otras preguntas

What is the value of y?
Can y’all help me on question 11?!
By comparing the time out mechanism used in TCP to that used in a data link layer protocol, outline why it is necessary for the TCP timeout mechanism to impleme
What factors generally determine whether a reaction happens or not? A. Reaction rate and color B. Presence of water and salt C. Enthalpy and entropy D. Keg and
HELP ASAP PLEASEE I WILL MARK BRAINLIST
Math please help This is my last work of the year
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha
Given. <1 and <2 are supplements , <3 and <4 are supplements, and <1 = <4 Prove : <2 = <3
Which table(s), if any, represents a proportional relationship? Explain.
Help please I’ll mark brainliest!!!! Which of the following graphs is a function of x?