mayap1
mayap1 mayap1
  • 07-03-2016
  • Spanish
contestada

Spanish 2: please answer all questions on this page

Spanish 2 please answer all questions on this page class=

Respuesta :

sofia448119 sofia448119
  • 07-03-2016
A-
1. abuelos 
2. prima 
3. primo
4. tios
5.padre
6. hermanos
7. abuelo

B-
1.condimentos
2. servilletas
3. tenedores y cuchillos
4. cucharas 
5. vasos
Answer Link

Otras preguntas

Social studies: Name 3 Native American tribes.
someone please help me with this math question please
You are on a house call with the veterinarian to evaluate some goats that are having "night blindness" per the owner. Upon arrival you can see that the goats ha
A gift basket that contains jars of jam and packages of muffin mix costs $45. There are eight items in the basket. Jars of jam cost $6 each and packages of muff
_____ are professionals with a Ph.D. or Psy.D. who have also completed a postgraduate internship. They specialize in assessment and treatment of psychological d
Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
The average atomic mass of iron is 55.845 amu. this average mass represents?
a bag contains 120 marbles. some are red and te rest are black . there are 19 red marbles for every black marble. how many red marbles for every black marbles .
allergies are an example of an infectious disease a noninfectious disease anxiety asthma
After a tenant gave notice and vacated an apartment, the landlord discovered substantial damage to the unit. No time was set in the lease specifying the length