elizabeth4fitnp8gsdm elizabeth4fitnp8gsdm
  • 09-05-2018
  • Mathematics
contestada

which of the following is the correct notation for the complex number
[tex] \sqrt{ - 81 - 14} [/tex]

Respuesta :

MsEHolt MsEHolt
  • 19-05-2018
The answer would be [tex]i\sqrt{95}[/tex].

-81-14=-95; this gives us √(-95).

The complex number i is defined as the square root of negative 1.  This means we can take this out of the square root, and that gives us
[tex]i\sqrt{95}[/tex]
Answer Link

Otras preguntas

please help I don't get it NO LINKS or I'll report pls don't answer the question if u don't know​
Please help with this question!
Nombre de los vecindarios pobres durante la Gran Depresión EE.UU?
State Lami's theorem​
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
Suppose the tax rate on interest income from saving were reduced. a. The income effect, but not the substitution effect, would tend to reduce private saving. b.
Please answer fast I will mark brainliest
Plz I need the answer!!!:( Select the correct items from the list. You can classify some languages into multiple categories. Pick the categories in which the C
. Solve the following1. Jane had 4 apples. She divided them so that she had just enoughfourths of an apple for each friend and herself. How many of themwere the
What is the formula for triphosphorus tetrasulfide?