Ashleeisawesome Ashleeisawesome

07-03-2018
Social Studies

contestada

A monopoly is a market for a good or service that? A. Has few competitive firms. B. Is perfectly competitive. C. Had one buyer. D. Has one seller.

Respuesta :

chapnmike chapnmike

07-03-2018

i believe it is B because for a monopoly it has no close substitute and is protected by a barrier that prevents other firms from selling that good or service

Answer Link

Otras preguntas

What was the final spur for southern secession? A: compromise of 1850 B:Missouri compromise C: election of Abraham Lincoln D: attack at fort sumter

The Justinian Plague had little effect on society in the Roman Empire society due to the size and power of the Empire. TRUE OR FALSE HURRY HURRY PLEASE

The force experienced by a unit test charge is a measure of the strength of an electric:

Why does caesar decide not to read artimidorus's letter? what does this say about caesars leadership?

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D

What two measurements of a wave do you need to calculate its speed?

Indentify the domain of the function shown in the graph

Read the sentence and select the activity or sport described. Esto es un deporte que es un buen ejercicio y mejora la coordinación óculo-manual. el footi

The weight of an African elephant is 6 × 10^6 grams; the weight of a tiger is 3 × 10^5 grams. How many times heavier is the elephant than the tiger? A) 2 grams

Points A, B, C, and D lie on line segment AD. If AB = 25, BC = 48, CD = 2 3 the length of BC. What is the length of AD?