pbanje2604 pbanje2604

07-09-2017
Business

contestada

When must a breach be reported to the u.s. computer emergency readiness team?

Respuesta :

inferno123 inferno123

07-09-2017

immediantly after it happens

Answer Link

Otras preguntas

When you are doing Rotations what is the easiest way to figure out which quadrant the figure should be in?

After the fall of the Khmer Rouge, how did the government of Cambodia change? 1) It became communist 2) It became a puppet government 3) It became democratic

The average size of a pair of women's shoes sold at a shoe store is size 8, with a standard deviation of 1.5 sizes. If the sizes are normally distributed, what

1)Sam needs 10 kg of lemons to make lemonade.If each of the bag weighs 1000 g how many bags does he need? 2)How many 250 g bags of grapes are needed to make 5 k

im giving 20 points pls help

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

For the graph below, what should the domain be so that the function is at least 200? A -5 less or equal to x less than or equal to 29 B 0 less than or equal to

Qué propone Saramago?

How I spent my holidays

In its prime, Mr. Ford's 2002 Focus would get 36 miles/gallon. Mr. Ford starts a road trip to San Bernardino, Barstow, Kingman, Winona, and Flagstaff, AZ. He st