ultraviolate4374 ultraviolate4374
  • 09-02-2024
  • Social Studies
contestada

Why are independence and accountability considered contradictory goals with respect to judged?
a) Independence leads to lack of accountability
b) Accountability undermines independence
c) Independence can lead to biased decisions
d) None of the above

Respuesta :

Otras preguntas

how was american able to produce war supplies?
The term _____ describes a condition in which the eye does not focus properly because of uneven curvatures of the cornea.​ a. nystagmus​ b. ​strabismus c. ​esot
how was american able to produce war supplies?
Which of these is an example of a domestic policy?
What technique can improve web search results? Add articles, prepositions, and pronouns Be general rather than specific Focus on keywords Use periods, comm
Hey can you please help me posted picture of question
since (3/4)^2=3/4•3/4=9/16 what is the value of 2/5^2
WHAT IS THE DEFINITION OF INDEMNITY
Administrative assistants are categorized in what occupational group?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3