nyababy9931 nyababy9931
  • 11-01-2024
  • Social Studies
contestada

which of these is a possible hypernym of sociolinguistics?
a. Linguistics
b. Language Change
c. Morphology
d. Phonology

Respuesta :

Otras preguntas

which of the following was not a contributing factor to the great depression
If you have lived during the Vietnam War explain why you would have been a hawk or dove
A is a work that idealizes the simple sherd's life
One endpoint of a line segment is at (4, 2). The line is bisected by placing the midpoint of the line segment at (−2, −1). What are the coordinates of the other
A rubber rod rubbed with fur acquires a charge of -4,8×10(-9)C. What is the charge on the fur? How much mass is transferred to rod?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Can someone please help me with number 25
which of the following was most likely not present in creating the amino acids of early earths waters of the past
The surgical correction of a damaged middle ear is known as _____.​ a. ​tympanoplasty b. ​otoplasty c. ​barotrauma d. ​fenestration
Erik erikson defines ________ as the gap between the security of childhood and the autonomy of adulthood.