kennettzone5907 kennettzone5907

10-11-2022
Biology

contestada

elow is the coding strand of a small gene that codes for a peptide. assume the gene has a traditional start codon. how many amino acids long is the peptide if we assume traditional start and traditional stop codon? 5' aatccgtatctatgaccgtttggaaacactaagcggtactc 3'

Respuesta :

Otras preguntas

What was the effect of the crusades on europe

Angela has five cakes she wants to cut them into 2/5 pieces how many pieces will she be able to cut

PLZ HELP What is the slope of the line that passes through the points (5, -11) and (-9, 17)? 1/3 3 -1/3 -3

the motion of a 12kg object is opposed by a 30N force of friction. at what rate does friction slow the object down

Help 4TH GRADE MATH!!!!!!!! About factors

The difference of the squares of two positive consecutive even integers is 36. Find the integers. Use the fact that, if x represents an even integer, then x+2 r

the lunch counter “sit-sins” were meant to

Drag each label to the correct location. Identify the genotypes for this pedigree chart.

Read the excerpt from When Birds Get Flu and Cows Go Mad! by John DiConsiglio. People all over the globe are observing World AIDS Day on December 1, 2006. Worl

Can someone please help me find the simple interest