kateliv3s
kateliv3s kateliv3s
  • 07-02-2017
  • History
contestada

who led the decoy army on D-day?

Respuesta :

DogiestDoge
DogiestDoge DogiestDoge
  • 07-02-2017
General George Patton led the decoy army on D-Day. The decoy army mostly consisted of fake, inflatable tanks.
Answer Link

Otras preguntas

50 PONITS HELP PLEASE
Hi I am not good at math so I need help please
Help !! Asap I need the answer before my class ends
what is one effect that an in medias res opening is meaant to have on the reader?
Evaluate?3/4 to the 3rd power)
Iron(iii) oxide is formed when iron combines with oxygen in the air. How many moles of Fe2O3 are formed when 55.8 g or Fe reacts completely with oxygen? 4Fe(s)+
Match the following items. 1. divide and conquer Robert E. Lee 2. commander of the Confederate Army General Scott's strategy 3. captured port of New Orleans Cap
What happens when a person living in one of those countries becomes seriously ill or has a bad accident? How far must they travel to see a doctor or go to a hos
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
Alex is the head photographer for the yearbook and the newspaper. She has a large staff of assistant photographers because they need to take pictures at all of