atreazure atreazure

09-03-2022
Biology

contestada

What is the mRNA that would be transcribed from this strand of DNA?

What is the mRNA that would be transcribed from this strand of DNA class=

Respuesta :

karisoar karisoar

09-03-2022

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

Answer Link

Otras preguntas

At a bake sale, Cheryl bought 7 packages of extra-large cookies for $28. Each package contained 2 cookies. What was Cheryl's price per cookie? Explain

Which of the following statements best describes the structure of the cell membrane?

20 POINTS!! PLZ HELP!!Bridge to Terabithia Chapter 10Why does Jess think he needs a gut transplant on page 56?

need help and don’t just give answer have a explanation at least then i’ll give u brain list

Adam has 6x dollars. Jimmy has $10 more than Adam. Paul has 2x dollars less than Jimmy. a.) Find how much money Jimmy has in terms of x. b.) Find how much mon

Mestizo or Mestiza is a term that describes people from two races mixed into one. These races are??____

B Complete with an appropriate word or phrase. Esquió / balón/ cancha / olas/ piscina / mar 3–4. El ____________________ tiene olas. La ____________________ no

what is the simplify answer of 5/6+3/4+2/3 write as mixed number, if possible.

Define falling action in your own words.

Write the equation for a parabola that has a vertex (2, -1) and a directrix of x = 5. The standard form for this parabola is (x - h)* = 4p(y-k) (y- k) = 4p(x -