sara723 sara723
  • 07-12-2021
  • History
contestada

why did Native Americans had to be taught time

Respuesta :

infinitywillix
infinitywillix infinitywillix
  • 07-12-2021
i’m not quite sure what this is asking but if i had to guess , it would be because native americans traditionally used the sun as a way to tell time instead of the more commonly accepted way which is clocks
Answer Link

Otras preguntas

Read the list of words. dermatologist epiderm hypoderm taxidermist pachyderms Based on the common root, all of these words relate to _______. a science b sk
Find the slope of the line.
Which male accessory structure is inferior to the urinary bladder and surrounds the superior portion of the male urethra?
HELP PLEASE What is a common issue with both tidal power and OTEC? Maintenance costs due to salt water corrosion Necessary temperature differences in the water
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Which issue could be considered the straw that broke the camel's back between the north and south?a) john brown's raidb) election of 1860c) the kansas-nebraska
How would you know if your results from experiment 2 show that the traits were inherited through mendelian genetics?
How does evolutionary change arise
PLZ HELP!!! *best answer gets brainliest*
When are two animals classified as belonging to the same species?