alyssaasheltonn765 alyssaasheltonn765

07-12-2021
Mathematics

contestada

Ain.
1.5 ft.
0.5 it.

What is the surface area of the figure in square inches help

Ain 15 ft 05 it What is the surface area of the figure in square inches help class=

Respuesta :

Аноним Аноним

08-12-2021

l=4in
b=0.5ft=6in
H=1.5ft=18in

[tex]\\ \sf\Rrightarrow LSA=2(h)(l+b)[/tex]

[tex]\\ \sf\Rrightarrow LSA=2(18)(6+4)[/tex]

[tex]\\ \sf\Rrightarrow LSA=36(10)[/tex]

[tex]\\ \sf\Rrightarrow LSA=360in^2[/tex]

Answer Link

Otras preguntas

4. Data from a random sample of 50 students in a school district showed a positive relationship between reading score on a standardized reading exam and shoe si

c) They actually pay $52.99. The additional $7 is a tip for the server. What percentage of the subtotal is the tip?

Find the volume of this triangular prism. Be sure to include the correct unit in your answer.

A symbol of life and of woman,the niloofar, or ________, is a common motif in Persian pottery.figure of Ishtarthe water lilythe lotus flowerthe moon

Find an equivalent fractions for each given fraction 70/10

Describe the form of government in ancient Egypt

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this m

Need some help plzzzz

Suppose Phil and Kate decide to drive the sports car to Nashville without stopping and they want to arrive by 5:00pm. What time should they leave their house?

Milicent finds a plant in her backyard. It is tall and has large cones. What did Milicent find? moss fern conifer flowering plant