rosalesmichellle rosalesmichellle
  • 08-11-2021
  • Mathematics
contestada

The figure below shows a circle inside of a square.
If the radius of the circle is 8 cm, find the area of
the shaded region

The figure below shows a circle inside of a square If the radius of the circle is 8 cm find the area of the shaded region class=

Respuesta :

devishri1977
devishri1977 devishri1977
  • 08-11-2021

Answer:

Step-by-step explanation:

Shaded region is the circle.

r = 8 cm

Area of circle = πr² = 3.14 * 8 * 8 = 200.96 cm²

Answer Link

Otras preguntas

A molecule can be made of which of the following? many elements a single element a single atom
25 points!! Help please!!! Will give Brainliest!!!
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
how to change one third into twelfths
What is \dfrac {9}m+4 m 9 ​ +4 when m=3m=3
Which statement about organism classified in the same genus is true?
the glorious revolution was a
in what direction do stars the moon and the sun seem to move across the sky why
A set of cards has 8 red cards, 6 blue cards, and 1 green card. Paula chooses a card without looking. What is the probability that Paula will choose a red card?
what is the name of the first work that charles dickins had published