unicorn11908
unicorn11908 unicorn11908
  • 08-12-2020
  • Biology
contestada

Answer this please thanks

Answer this please thanks class=

Respuesta :

kaelamichelle2006
kaelamichelle2006 kaelamichelle2006
  • 08-12-2020

Answer:

same genotypes

Explanation:

Answer Link

Otras preguntas

x+y=4 2x+3y=9 how can i find out if its independent , consistent, and dependent or inconsistent
Solve the equation by completing the square y^2-6x+4=0
Marlon's credit report indicates non-payment of a credit card bill. which act passed by congress can help him correct this error?
In “Borders,” by Thomas King, the mother’s refusal to declare either American or Canadian citizenship is best explained by her character’s
What are sources or starting places of many ideas in the constitution?
a science museum offers tours for school groups with 20 or more students. the tour costs $100 plus $3.50 for every student in excess of 20 students. a school gr
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
How did the great depression affect the lives of urban and rural america?
Why would former slaves and Radical Republicans describe the state of affairs following the Compromise of 1877 as worse than slavery? Support, refute, or modify
A car dealership has 240 cars in the parking lot and 17.5% of them are red. Of the other 6 colors in the lot each color has the same number of cars. If one of t