shafique shafique
  • 08-11-2020
  • Biology
contestada

Why is meiosis cell division called reductional division?

Respuesta :

anitaupadhyaybmc
anitaupadhyaybmc anitaupadhyaybmc
  • 08-11-2020

Answer:

Meiosis is called reductional division because number of chromosomes and amount of DNA in daughter cells is reduced to half than that of parent cell.It is called equational division because number of chromosomes and amount of DNA in daughter cells remain equal to parent cells.

Explanation:

Hope this helps

Crown me as brainliest:)

Answer Link

Otras preguntas

Psychological stress can increase a person’s susceptibility to disease. a) true b) false
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC Complementary Strand:
Write the standard equation of a circle that passes through (1, −6) with center (7, −2). A: (x + 1)2 + (y – 6)2 = 52 B: (x + 7)2 + (y – 2)2 = 52 C: (x – 1)2 + (
If h (r) =2/3r -6 what is the value of h(-9)
Create an abstract Division class with fields for a company's division name and account number, and an abstract display() method that will be defined in the sub
What does explicit mean
The Following system of equations can be used to find the price of a notebook in dollars. n and the price of a pencil in dollars p 7n + 4p =6.40 2n +19p = 5.40
2000 fun size snickers have dimensions 2 inches by 1/2 in by 1 in. Today a fun size snickers has dimensions 1 1/2 in by 1/4 in by 1/2 in. What is the percent de
The theory of plate tectonics explains how some coastal mountain ranges may have been formed. True False
please help asap on geometry !!!!