heyselclaros31 heyselclaros31

06-10-2020
Biology

contestada

If all the leaves were shriveled on a plant, what process would not be able to happen

Respuesta :

miggypillerva14 miggypillerva14

06-10-2020

Answer:

fajamarutation process

Explanation:

Answer Link

heavensent10 heavensent10

06-10-2020

i think it’s photosynthesis ?

Answer Link

Otras preguntas

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

How to Factor r^2-5r-14

which information should he include in the MLA in text citation ?

According to Kuhn, the set of beliefs, values, assumptions, and a particular way of doing research which are accepted by a group of scientists is called:

Ethical dilemmas related to which of the following issues have come up with the growth of social media? For example, it is easy to be deceptive online. If you w

The ________ is the outermost covering of a fruit. endocarp pericarp exocarp mesocarp

1. A 48-foot rope is cut into three lengths. The second length of rope is twice the first length. The third length of rope is one fifth the first length. What i

A personal trainer is advising a client on caloric distribution. Which of the following falls within the Acceptable Macronutrient Distribution Range (AMDR) for

An ideal air-filled parallel-plate capacitor has round plates and carries a fixed amount of equal but opposite charge on its plates. All the geometric parameter

Which one of the following sentences is correctly punctuated? A. She named him Sterling that was her grandfather's name. B. Sterling looks just like his si