adoreeharm adoreeharm

10-01-2020
Mathematics

contestada

You went to 23 houses trick or Treating and you get 3 pieces of Candy at each house how much candy do you have Total ?

Respuesta :

tloh677 tloh677

10-01-2020

Answer:

69 Pieces of candy

Step-by-step explanation

So you get 3 pieces of candy at every house. And you do that 23 more times. We can right that out as 23*3. Which is 69.

Answer Link

Otras preguntas

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Five less than three. Times the length L

how do the domain and range of f(x)=(1/2)^x compare to the domain and range of f(x)=(2)^x?

3x minus one over five times the quantity 10x plus 5 equals 6 Step 1: 3x – 2x – 1 = 6 Step 2: x – 1 = 6 Step 3: x – 1 – 1 = 6 – 1 Step 4: x = 5 In which step

3y=4x+15 and 9x+12y=12 are perpendicular,parallel or neither

In the last 60 days over 435 billion text messages were sent in the United States alone Which type of audience appeal does the statement show? A. Ethics B. L

Can someone help me with 9?

Check out if I'm right Plz explain..if u have a different answer

What part of a supreme court decision presents the argument in opposition to the courts ruling ?

How to convert 3x-5y=6 to slope intercept form