ultraclutch2468 ultraclutch2468

06-11-2019
Mathematics

contestada

Four plane tickets cost $900. What is the unit rate?

Respuesta :

gracepalomo19 gracepalomo19

06-11-2019

Answer:

$225

Step-by-step explanation:

900 divide by 4 equals 225

Answer Link

musiclover10045 musiclover10045

06-11-2019

Unit rate = total cost / quantity

Unit rate = $900 / 4

Unit rate = $225

$225 per ticket.

Answer Link

Otras preguntas

Help ASAP need answer:)

1. The backdrop of the altar in a church is triangular in shape. It has a base of 10.5 metersand a height of 8.5meters. The priest instructed the layman to cove

you intend to carry out a field study in a weather station why would you carry out a pre visit

Which animal is strongest physically. (not compared to their size)

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

2//2/2/3/2/2//3/3/3//3/3/4/5/5

Replace the subject with a subjective pronoun in the following sentence: Pablo and I ate lunch. What is the correct pronoun to use? Us, They, We, or She?

Who is right and why are they right?

solve 15 3/4 ÷ 2 5/8 × 5 5/6 ÷ 8 2/5

Helpppppppppppppppp its timeddddddddddd